Advertisement

Highly scalable arrayed CRISPR mediated gene silencing in primary lung small airway epithelial cells

Open AccessPublished:January 13, 2023DOI:https://doi.org/10.1016/j.slasd.2023.01.003

      Introduction

      Small airway epithelial cells (SAECs) play a central role in the pathogenesis of lung diseases and are now becoming a crucial cellular model for target identification and validation in drug discovery. However, primary cell lines such as SAECs are often difficult to transfect using traditional lipofection methods; therefore, gene editing using CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 is often carried out through ribonucleoprotein (RNP) electroporation. Here we have established a robust, scalable, and automated arrayed CRISPR nuclease (CRISPRn) screening workflow for SAECs which can be combined with a myriad of disease-specific endpoint assays.
      CRISPRn screening is powerful tool for identifying and validating potential drug targets associated with disease phenotypes and can be carried out in immortalised or primary cell types. Screening with primary cells is typically more disease-relevant facilitating better clinical translation of the targets identified, however, these cells are generally more challenging to culture, expand, and manipulate genetically. Therefore, to enable the screening of as many genes as possible in primary cells, this protocol has reduced the cell number and reagent required per gene electroporation, whilst ensuring the maintenance of CRISPR editing efficiency. This screening protocol has enabled the benefits of both immortalised and primary cell lines to be utilized, by carrying out a larger scale screen (e.g. genome wide) in a disease-relevant immortalised cell line, with the top hits then carried forward into a smaller, targeted validation screen using a disease-relevant primary cell line. Following the genetic identification and validation of a potential drug target, downstream assays to assess the biological activity, safety, and most suitable drug modality should be carried out to continue the drug discovery process.
      The protocol detailed here is focused upon CRISPRn editing in SAECs. Other gene silencing methods such small interfering-RNA (siRNA) can also be powerful tools in drug discovery when looking at essential genes, or where complete knock-out is not required. However, this method is associated with increased off-target effects and analysis challenges when compared to CRISPRn screening. A challenge for all editing capabilities in primary cell lines is the delivery of cargo, which is a crucial optimisation step for each individual cell line.
      The protocol detailed here has been built to phenotypically assess individual gene deletions in a high throughput format. Due to the large number of genes knocked-out during the screening protocol, it is impractical to assess the editing efficiency of each individual gene. Therefore, it is critical to include editing controls such as lethal genes and genes which drive or reduce the desired endpoint phenotype to ensure confidence in the editing efficiency and automation workflow.
      Another important control during CRISPRn screening is the neutral editing control. This control is a gene which does not affect the phenotype of interest and should be used across the editing and endpoint assay plate. Neutral controls are crucial during the analysis of the endpoint assay to ensure that the phenotype of interest can be normalised to CRISPR edited cells rather than unedited cells which could have a survival or proliferative advantage [
      • Wang B.
      • Wang M.
      • Zhang W.
      • Xiao T.
      • Chen C.
      • Wu A.
      • Wu F.
      • Traugh N.
      • Wang X.
      • Li Z.
      • Mei S.
      • Cui Y.
      • Shi S.
      • Lipp J.J.
      • Hinterndorfer M.
      • Zuber J.
      • Brown M.
      • Li W.
      • Liu X.S
      Integrative analysis of pooled CRISPR genetic screens using MAGeCKFlute.
      ]. In this protocol a guide RNA (gRNA) targeting the adeno-associated virus integration site 1 (AAVS1) safe harbor site has been used as the neutral control. This site is regularly used for genetic manipulations due to its open chromatin structure and as disruption has no known adverse effects, but it is important to confirm this control when using new cell types [
      • Smith J.R.
      • Maguire S.
      • Davis L.A
      • Alexander M.
      • Yang F.
      • Chandran S.
      • ffrench-Constant C.
      • Pedersen R.A
      Robust, persistent transgene expression in human embryonic stem cells is achieved with AAVS1-targeted integration.
      ].
      The protocol described here requires access to high throughput liquid handling automation and a 384 well nucleofector. Following CRISPRn editing, this screening workflow can be adapted to evaluate many disease-specific endpoint assays and therefore the equipment requirements will be assay specific. As an example, endpoint assays could include high content confocal immunofluorescence imaging.
      For further details of the execution of this protocol, please refer to the supplemental material.

      Materials

      Reagents

      Tabled 1
      ReagentSupplierCatalogue numberStorage
      General reagents
      Cell Carrier Ultra (CCU) 384 well plates (PhenoPlate)Perkin Elmer6057300Room temperature (RT)
      Armadillo high performance 384-well PCR plateThermo ScientificAB-2384RT
      Echo 384 PP 2.0LabCytePP0200RT
      Masterblock 384 deep well plateGreiner781271RT
      Cell culture reagents
      Normal Small Airway Epithelial cells (SAECs)LonzaCC- 2547Frozen – Liquid nitrogen

      Culture – 37°C
      SABM small airway epithelial cell growth basal medium bullet kitLonzaCC-31184°C
      Dulbecco's phosphate buffered saline (PBS)SigmaD8537RT
      Animal component free (ACF) dissociation solution and enzyme inhibition solutionStem Cell05426Aliquoted at -20°C, 4°C for short term use
      CRISPR editing reagents
      P3 primary cell 384HT nucleofector KitLonzaV5SP-3002RT /4°C for P3 buffer
      10 mM Tris-HCl buffer pH 7.4Horizon DiscoveryB-006000-100RT
      Alt-R® S.p. Cas9 nuclease V3, 500 μg *IDT1081059-80°C
      Alt-R® Cas9 electroporation Enhancer *IDT1075915/6-20°C
      CRISPR gRNA – Edit-RTM tracrRNA*Horizon DiscoveryU-002005-20°C
      CRISPR gRNA – Edit-RTM crRNA controls and library *Horizon DiscoveryVarious depending on gene (s)-20°C
      CRISPR gRNA - Edit-RTM lethal crRNA control 1 *Horizon DiscoveryU-006000-01-20-20°C
      Neutral editing gRNA control: Edit-RTM CRISPR crRNA Human AAVS1 (adeno-associated virus integration site 1) *Horizon DiscoveryCustom sequence:

      5’ GCCAGTAGCCAGCCCCGTCC
      -20°C
      *Keep CRISPR editing reagents on ice as much as possible during the editing process.
      Alternatives: The protocol described here used two-part Edit-RTM CRISPR gRNAs (Horizon Discovery) composed of a common tracrRNA and specific crRNAs for each gene of interest in the library and all control genes. It is likely that this protocol can be adapted for use with one-part sgRNAs from multiple vendors. Additionally, the protocol described used Alt-R® Sp.Cas9 (IDT), however, it is likely that this protocol can be adapted for use with different Cas9 proteins from different vendors, so long as the Echo dispensing step is checked and optimised (see Procedure step 8 for more information).
      Note: The protocol described here uses a neutral editing control gRNA targeting AAVS1. Prior to carrying out this protocol, it is important to check that editing AAVS1 is an appropriate neutral editing control for the desired cell type and does not affect the phenotype of interest when compared to unedited cells.

      Equipment

      Tabled 1
      Specific equipment requiredSupplier
      384 HT Nucleofector SystemLonza (catalogue number: AAU-1001)
      Bravo Liquid Handler with 384 well tip headAgilent
      Echo Acoustic Liquid Handler 555Beckman Coulter
      Thermo Scientific Multidrop CombiThermoFisher Scientific (5840300)
      Standard tube dispensing cassette for Thermo Scientific Multidrop CombiThermoFisher Scientific (24072670)
      General equipment capabilities
      Cell counter
      Light microscope
      Refrigerated centrifuge
      Specific equipment for endpoint – as an example, a Yokogawa Cell Voyager CV7000 could be used for a high content confocal immunofluorescence assay.

      Software

      This protocol requires the use of the Echo acoustic liquid handler and the Bravo liquid handler. These both have software associated which is needed to program and drive the automation. The specific Echo software required to carry out this protocol is the Echo Cherry Pick software (Beckman Coulter).
      The software required for the end point screening assay will be dependent upon the assay but could include image analysis software.

      Procedure

      Cell culture of SAECs

      This step describes the optimal thawing and culturing of the SAECs prior to CRISPR editing. This culturing protocol should achieve approximately 30 million cells from a single vial of cells.
      Timing: 8 days.
      • 1
        Day 1 - Thaw one vial of SAECs from Lonza (CC-2547, ∼500,000 cells).
        • a
          Make up the complete SABM growth media as detailed by the manufacturer and pre-warm before adding to cells.
        • b
          Thaw cryovial at 37°C for two minutes.
        • c
          Dilute the thawed vial of cells (1 mL) into 29 mL of growth media and place 15 mL into two T75 tissue culture flasks.
          NB: use approx. 1 mL of media per 5 cm2 at this stage.
        • d
          Place the flasks in an incubator at 37°C, 5% CO2.
      • 2
        Day 2 – 24 hours post thaw, replace the growth media to remove DMSO component.
      • 3
        Day 4 - Passage the SAECs 48 hours later (72 hours after thaw). Dissociate the cells from the flasks using the ACF dissociation and inhibition solution and perform a cell count.
        • a
          Remove growth media and wash with approx. 10 mL PBS.
        • b
          Incubate cells in ACF dissociation solution for 5 mins (or until detached) at 37°C before adding an equal volume of ACF enzyme inhibitor solution to neutralise the enzyme.
          NB: Volumes of ACF solutions for a 75 cm2 flask are approx. 4 mL, adjust accordingly for other flask sizes.
        • c
          Wash the cells with PBS by centrifugation (400 xg, 4 mins, RT) and resuspend the cells in growth media.
        • d
          Perform a cell count on appropriate cell counting device.
      • 4
        Seed the SAECs at ∼5,000 cells per cm2 in appropriate tissue culture flasks (e.g. T175s).
        NB: SAECs can be seeded at 2,500 cells per cm2, but little difference between these densities were observed.
      • 5
        Day 6 - Perform a growth media change 48 hours after seeding the cells.
        NB: As the cells increase in confluency, use approx. 2 mL media per 5 cm2.
      • 6
        Day 8 - Approximately 96 hours post seeding the cells should be approx. 75% confluent and ready for electroporation.
        NB: Avoid letting SAECs go over 80% confluency as this can affect growth.
      Critical: It is critical that this protocol is carried out from a fresh vial of SAECs from Lonza which are cryopreserved and provided at passage 2. To maintain cell health during culture, it is important to change the media on the SAECs every 48 hours.
      It is highly recommended to use the SAECs for CRISPR editing via RNP electroporation between passage 4 and 5 to obtain optimal CRISPR editing efficiency and post electroporation viability.
      Note: It is recommended that SAECs are not centrifuged upon revival due to detrimental effects on cell viability.

      Preparation of ribonucleoprotein (RNP) plate

      This step describes the generation of the ribonucleoprotein (RNP) plate for CRISPR editing.
      The whole screening automation workflow (covering ‘Preparation of ribonucleoprotein (RNP) plate’ ‘CRISPR editing of SAECs’ and ‘Cell handling post electroporation’) is summarised in Figure 1.
      Figure 1:
      Figure 1SAEC CRISPRn screening by RNP electroporation workflow.
      This schematic gives an overview of the CRISPR screening workflow, from RNP complex formation, electroporation, and dispensing the edited cells into assay plates.
      ©Agilent Technologies, Inc. Reproduced with Permission, Courtesy of Agilent Technologies, Inc.
      ©Lonza, reproduced with permission.
      ©2022 Beckman Coulter, Inc. Used with Permission.
      Due to reagent and cell number limitations of gRNAs and SAECs respectively, during the optimisation of this protocol, different cell number and reagent concentrations for editing were assessed (see supplementary Figure 1 for further information). Both high and low reagent conditions produced comparable editing efficiency. Therefore, reagent concentrations and cell numbers can be adjusted dependent on needs, however, the overall reagent ratio should remain the same. In the protocol described here, the low reagent condition has been detailed.
      Timing: 2 hours
      • 1
        Edit-RTM crRNAs used in this protocol were provided lyophilized from Horizon Discovery in an Echo 384 PP 2.0 plate at 0.5 nmol per gene (4 crRNAs per gene in a pool) and one gene per well.
        Complex Edit-RTM crRNAs with Edit-RTM tracrRNA at a final concentration of 10 μM.
        • a
          Once received, non-resuspended crRNA plates should be stored at -20°C until use.
        • b
          Before resuspension, briefly centrifuge the crRNA plate (200 xg, 1 minute) and resuspend in 50 μl of 10 μM Edit-RTM tracrRNA (resuspended in 10 mM Tris-HCl Buffer pH 7.4). This can be carried out manually using a multichannel pipette or could be adapted for the Bravo or other liquid handler if desired.
          This creates a final crRNA:tracrRNA (gRNA) complex at 10 uM.
        • c
          Briefly centrifuge the plate as before to ensure all liquid is at the bottom of the plate.
        • d
          Leave the plate at RT for 30 mins to allow the tracrRNA and crRNA to complex before further use.
      • 2
        Using the Echo Cherry Pick software on the Echo 555, transfer 2 μl of each gRNA into the appropriate well of the RNP plate (a 384 well PCR plate).
        • a
          For the Echo 555, the AQ_BP2 liquid class should be selected.
      Note: Dispensing 2 μl of the complexed gRNA into the RNP plate could also be carried out using a liquid handler (e.g. Bravo) if the plate layout of the gRNAs is appropriate. However, using the Echo Cherry Pick software enables the plate layout to be easily modified. This gives users the ability to re-use the gRNA plate in multiple experiments with scope for adaptations, whilst also enabling users to modify the plate layout for increased statistical confidence.
      The protocol described here is for gRNAs complexed and resuspended at 10 μM. This protocol could be adapted for gRNAs resuspended at different concentrations as required, so long as the dispensing volume of gRNAs and final volume are adjusted to ensure the final concentrations and volumes are as described in this protocol.
      Critical: If any errors occur after the Echo Cherry Pick protocol is complete this is likely due to bubbles in the gRNA plate. For further information see troubleshooting problem 1.
      It is critical to include lethal control genes, and neutral (genes which do not affect the phenotype of interest) and positive (genes which drive the phenotype of interest) phenotype editing controls in the experimental plate design. These controls should be distributed across the plate; for an example plate layout see Figure 2, however, this can be modified as required.
      Figure 2:
      Figure 2Example 384 well plate layout for screening including lethal, neutral, and positive controls.
      This schematic gives an example final 384 well assay plate layout for CRISPRn screening with SAEC cells. Lethal controls (red) are used to give confidence in the editing workflow, and neutral e.g. adeno-associated virus integration site, AAVS1 (green) and positive (orange) controls are to be endpoint assay specific controls used to ensure the accurate normalisation of CRISPRn screening results. Light grey wells indicate a CRISPR edited well with the library of interest. Dark grey wells indicate media only.
      For 384 well screening it is important to limit the use of the edge wells in the assay where possible to reduce edge effects in the end point analysis.
      Using these gene controls helps to give confidence that the editing and automation workflow has been successful and gives neutral and positive controls for the endpoint assay for normalisation purposes. Neutral controls are required here for normalisation rather than unedited cells, as CRISPRn editing itself (regardless of the gene) can affect cell health and growth and can therefore affect endpoint analysis. For further information see troubleshooting problem 2.
      NB: lethal and neutral control gene options have been discussed in this protocol, however, any positive controls will be endpoint assay dependent.
      Pause point 1: After crRNA and tracrRNA complexing and resuspension, plates can be firmly sealed to limit evaporation and stored at -80°C until further use.
      Pause point 2: After Echo dosing the complexed crRNA and tracrRNA into the RNP plate, the RNP plate can be left overnight at 4°C with appropriate sealing.

      CRISPR editing of SAECs

      This step describes the CRISPR editing process of SAECs using a 384 well nucleofector.
      Timing: 4 hours.
      • 1
        Cas9 dosing for RNP complex formation
        • a
          Transfer 50 μl Alt-R® S.p. Cas9 into appropriate wells of a 384 PP 2.0 ECHO source plate. The number of Echo wells dispensed will be determined by the number of transfers to wells needed.
          NB: For this Echo transfer calculation, take into consideration approx. 20 μl dead volume per well in the source plate.
          For example, for a complete 384 well plate 4 wells of an Echo source plate should be filled with 50 μl Cas9.
        • b
          Echo dose 0.25 μl Cas9 into a 384 well PCR plate(s) to generate the RNP complex with crRNA:tracrRNA guides. It is recommended to use the AQ_BP2 setting on the Echo 555 when using Alt-R® S.p. Cas9.
        • c
          Protect with a suitable PCR plate seal or an appropriate plate lid and centrifuge the RNP plate (300 xg, 1 min).
        • d
          Allow 30 minutes at room temperature for RNP complex to form in plate.
          NB: RNP complexes are stable at room temperature for up to 2 hours.
      • 2
        Addition of SAECs to RNP plate
        • a
          Remove cells from cell culture flasks as detailed above in Procedure step 3 and pool all cells in a tube.
        • b
          Centrifuge the cells (400 xg, 4 mins) and remove the supernatant.
        • c
          Resuspend cells to a final volume of 20 mL in growth media.
        • d
          Perform a cell count on appropriate cell counting device.
        • e
          Work out the volume of cell suspension required according to the following calculations. It is recommended to prepare enough cells for 700 reactions which will allow dispensing of cells to all 384 wells of the RNP plate with enough dead volume (approx. 7 ml) for dispensing using the Thermo Scientific Multidrop Combi.
      Volume required:
      19.85 ul x 700 = 13,895 ul = 700 reactions.
      Cells required:
      1 X Reaction (well) = 6.25 × 104 cells in 19.85 μl
      700 X Reaction (wells) = 4375 × 104 cells in 13,895 μl
        • a
          Remove the required volume of cell suspension and place into a new 50 mL tube.
        • b
          Centrifuge the cells (400 xg, 4 mins) and remove the supernatant.
        • c
          Resuspend cells in 20 mL PBS and wash by centrifugation (400 xg, 4 mins). Remove the supernatant leaving only the cell pellet. This ensures removal of any serum which may interfere with the electroporation procedure.
        • d
          Resuspend cells in 13.895 mL complete P3 buffer.
          NB: complete P3 buffer involves mixing the provided supplement 1 with the P3 solution at a 1:4.5 ratio following the manufacturer's instructions (complete P3 buffer is subsequently referred to in this protocol as P3).
        • e
          Add 105 μl of electroporation enhancer (100 μM) to cells in P3 buffer and gently vortex to mix. The cells are now ready for dispensing onto the RNP plate on top of the RNP complex.
        • f
          Transfer 20 μl of cells/well to the 384 well RNP plate using an Thermo Scientific Multidrop Combi cassette (recommended settings changed to 384 low volume plate, standard cassette, 20 μl, dispense height 11.00 mm, speed medium).
          NB: The settings may be adapted according to the RNP plate type used and it is recommended to test dispense an empty plate with water to ensure optimal settings.
        • g
          The RNP plate with cells is now ready for Bravo transfer to an electroporation cassette.
      Electroporation cocktail (per well of a 384 well PCR plate):
      Tabled 1
      ReagentFinal concentrationAmount
      crRNA:tracrRNA (10 μM)18.75 pmol2 μl
      Cas9 protein (10 μg/ μl)15 pmol0.25 μl
      Electroporation enhancer (100 μM)15 pmol0.15 μl
      Cells in P3 Primary cell buffer6.25 × 104 cells + enhancer in 20 μl P3 buffer19.85 μl
      Total volume22.25 μl
      • 1
        Electroporation
        • a
          Bravo transfer 20 μl of cells/RNP to a new 384 well electroporation cassette.
          The following transfer steps are recommended > Use 70 μl tips > Mix 10 μl (1 x mix) in RNP plate at a slow setting > Aspirate 21 μl from RNP plate > Dispense 20 μl to electroporation cassette.
        • b
          Transfer electroporation plate to the 384 HT nucleofector system. Adjust the settings for a 20 μl electroporation reaction and use programme CM-138-AA. A successful electroporation event is indicated by green wells on the software.
        • c
          The electroporated cells are now ready for Bravo transfer to assay plates.
      CRITICAL: It is critical that there are no bubbles in the wells of the electroporation plate. This may result in a failed electroporation well which will be indicated by an orange/red well on the software (see troubleshooting problem 3). Bubbles may be caused by presence of serum in the P3 electroporation cocktail, so a PBS wash step is included to prevent serum transfer. Bubbles may additionally be caused by the Bravo transfer. It is recommended in the protocol to aspirate 21 μl from the RNP plate and dispense 20 μl to the cassette to avoid any air bubbles.
      It is critical that cells are not centrifuged in P3 buffer.
      Optional: The protocol has been designed for an arrayed CRISPRn screen in a full 384 well plate. Volumes can be adjusted if more or less wells are required.
      Note: The automation steps, including using the Thermo Scientific Multidrop Combi to dispense cells to the RNP plate and automated transfer, have been optimised to increase robustness and reproducibility of the protocol. It is possible to do these steps manually with a multi-channel pipette.
      Note: Prior to editing, the viability of the SAECs should be assessed whilst carrying out cell counting. For the editing to be successful the viability of the SAECs should be >70%.
      Pause point 3: Following detachment and pooling of cell pellets to a final volume of 20 mL in media, the protocol can be paused for approx. 30 minutes while the cells remain in fresh media.

      Cell handing post electroporation

      The post electroporation steps will allow stamping of the electroporated cells from the cassette into assay plates. The assay plates may then be used to perform functional cellular assays and enable high throughput phenotypic and/or genotypic screening.
      Timing: 2 hours
      • 1
        Removal of cells from electroporation cassette
        • a
          Pre-warm a sterile 384 deep well plate with cell culture media containing 130 μl per well. This step may be performed with a Thermo Scientific Multidrop Combi cassette (settings changed to 384 deep well plate, standard cassette, 130 μl, speed high)
          NB: a short centrifuge pulse is recommended here to ensure all the media is at the bottom of the plate.
        • b
          Prewarm cell culture assay plates with 50 μl media.
          NB: place growth media in all wells of the plate even if using fewer wells in the electroporation. This is to limit evaporation and plate variability.
        • c
          Bravo transfer 40 μl of media from the deep well plate to the electroporation cassette, mix gently to resuspend cells, and transfer 40 μl of cell suspension back to the deep well plate.
          The following transfer steps are recommended > Use 70 μl tips > Mix 30 μl (1 x mix) in deep well plate at a slow setting > Aspirate 40 μl from deep well plate > Dispense 40 μl to electroporation cassette > Mix 40 μl (1 x mix) in electroporation cassette at a very slow speed setting > Aspirate 40 μl from electroporation cassette > Dispense 40 μl to deep well plate.
        • d
          At this point in the protocol there will be cells remaining in the electroporation cassette in a volume of 20 μl. The cells may also be aggregated to the sides of the wells. Bravo transfer 40 μl of media/cells from the deep well plate to the electroporation cassette, mix to resuspend cells, and transfer 50 μl of cell suspension back to the deep well plate. It is advised to adjust Bravo settings to perform mixing steps on the left-hand side, right-hand side, and in the center of the electroporation cassette well to aid with optimal cell removal.
          The following transfer steps are a recommendation > Use 70 μl tips > Mix 40 μl (3 x mix) in deep well plate at a medium speed setting > Aspirate 40 μl from deep well plate > Dispense 40 μl to electroporation cassette > Mix 40 μl (3 x mix) in electroporation cassette at a medium speed setting on left hand side of the well > Mix 40 μl (3 x mix) in electroporation cassette at a medium speed setting on right hand side of the well > Mix 40 μl (3 x mix) in electroporation cassette at a medium speed setting in middle of the well > At this point the electroporation cassette can be checked under a microscope to observe if any aggregates of cells appear > Aspirate 50 μl from electroporation cassette > Dispense 50 μl to deep well plate.
        • e
          At this point in the protocol the majority of cells will have been removed from the electroporation cassette to the deep well plate which will now contain 140 μl/well suspension with approx. 450 cells/μl. With the Bravo, transfer cells from the deep well plate to the multi-well 384 assay plates. The transfer volumes to media containing plates can be adjusted based on seeding density required for desired downstream assay.
          The following transfer steps are a recommendation > Use 70 μl tips > Mix 50 μl (3 x mix) in deep well plate at a medium speed setting > Aspirate 20 μl from deep well plate > Dispense 20 μl to assay plate containing 50 μl media > Repeat aspiration and dispensing steps for other assay plates.
          This may be performed in batches of three assay plates, and it is recommended to include a mixing step in the deep well plate following each three-plate transfer.
        • f
          Assay plates may then be transferred to an incubator at 37°C, 5% CO2.
      • 2
        Four- or five-days post editing, using a light microscope, check that the SAECs in the lethal edited control wells contain no/very few live cells and that the neutral edited wells contain an even distribution of live cells (see Figure 3).
        Figure 3:
        Figure 3Representative images of SAECs edited with the neutral and lethal control.
        Representative confocal images of SAECs five days following CRISPRn editing with a neutral or lethal editing control. Here, SAECs were fixed with paraformaldehyde (PFA) and stained with a DNA stain (DAPI) before being imaged. Wells edited with the lethal control should contain no live cells, whereas cells edited with the neutral control should contained many live cells.
        Once this is confirmed, the desired endpoint assay can be carried out on the assay plates.
      Note: The number of assay plates required, and the cell number seeded will depend on the endpoint assay of interest, so the exact volumes can be adapted here to suit the assay needs.
      Optional: Primary cells are particularly sensitive following electroporation, and it is recommended to use media (in deep well plate and assay plates) without addition of antibiotics. 24 hours post electroporation a media change can be performed in the assay plates to replace media with media containing antibiotics.
      A simple media change step using the Bravo is optional 2 days post electroporation as per SAECs normal culturing condition, depending on assay length.
      Note: The two-step transfer process of cells from the electroporation cassette to the deep well plate has been designed and optimised to ensure optimal cell retrieval with maintenance of high cell viability.

      Endpoint assay

      Prior to carrying the endpoint assay out is important to check the lethal controls to confirm they have been edited and control no/very few live SAECs (see troubleshooting problem 2).
      Following the CRISPR editing and seeding in to assay plates using the Bravo as described above, four or five days following SAEC editing, the plates will be ready for use in the desired endpoint assay. As an example, an endpoint could assess changes in a targeted transcriptomic high-content imaging ViewRNA™ Cell Plus Assay (ThermoFisher Scientific, #88-19000-99) assay with different gene knockouts. This assay enables the assessment of specific transcripts of interest. Alternatively, an immunofluorescence imaging assay using your desired antibodies of interest and high throughput confocal microscope (e.g., Yokogawa Cell Voyager CV7000) could be used as an endpoint assay to assess protein levels or localisation changes with different gene knockouts.

      Summary workflow figure

      Troubleshooting

      Tabled 1
      ProblemSolution
      1. An error message is displayed following the gRNA or Cas9 dosing during the Echo dispensing.Following the completion of a Cherry Pick protocol, if there are any errors, an error message will appear detailing which wells failed to dispense correctly. This will likely be due to bubbles in the stock plate containing the gRNA/Cas9. To rectify this, re-centrifuge the gRNA/Cas9 stock plate (400 xg, 1 min), check there are no visible bubbles, and attempt these specific wells again using a new modified Cherry Pick protocol. If the problem still persists, if able, the gRNA/Cas9 can be transferred manually using a pipette.
      2. Four- or five-days post CRISPR editing, the lethal edited control wells look no different from the neutral control wells and are still healthy and growing.If the lethal controls are still alive and growing a few days following editing, it is likely that something went wrong during the editing experiment and that the editing has been suboptimal. If this is the case, due to the lack of confidence in the editing, the experiment will need to be repeated. It would be recommended here that a small-scale experiment is trialed first to ensure all that all automation and reagents are working correctly.
      3. Following electroporation with the Lonza 384 HT nucleofector, some of the wells are highlighted on the software in red or amber.This indicates that there was an error during electroporation, likely due to bubbles in the specific well. It is important to make note of any errors. Red errors indicate that the electroporation has failed, whereas amber indicates there has been a suboptimal electroporation event and those particular wells should be proceeded with caution.

      Anticipated Results

      Following completion of this protocol, it is anticipated that the assay plate(s) seeded will have consistent SAEC numbers across the plate (see supplementary figure 3 for a representative 384 well plate). It is also expected that if the SAECs have been edited efficiently, the wells edited with the lethal control crRNA described in this protocol will not contain any live or growing SAECs four- or five-days following electroporation (see Figure 3). The efficient editing of the lethal controls should be confirmed by visual light microscopy before proceeding to the desired endpoint assay analysis.

      Limitations

      This protocol has been optimised for the CRISPRn editing of SAECs in one 384 well electroporation plate due to the limited expansion capacity of SAECs. If it is required to assess more genes, it may be possible to scale up the protocol, however, this has not been tested in this current protocol and would likely require starting with more than one vial of SAECs. Additionally, due to the number of different genes edited during this protocol, it is impractical to assess the editing efficiency of each individual gene. Therefore, it is crucial to include the editing controls discussed in this protocol.
      It is also worth considering replicates of CRISPRn screenings in more than one donor to give more confidence in the genes identified as positive hits in the endpoint assay analysis. Technical assay replicates can be generated using the Bravo to seed multiple assay plates from the one electroporation event. However, carrying out a replicate experiment editing fresh SAECs will provide additional statistical confidence in the hits identified. This protocol has described the optimisation of editing efficiency in two primary SAEC donors (see supplementary figure 2). It is worth noting that there could be variability between the editing efficiency of different SAEC donors. Therefore, it is recommended to carry out a small-scale proof of concept experiment with each SAEC donor used prior to large scale screening.
      Since the optimisation of this protocol, we have some experience adapting this protocol for use with other primary cell lines and with different endpoint assays which have impacted multiple projects and disease areas. When adapting this protocol for other cell types, it is crucial to optimise the initial culture conditions, electroporation cell density, and electroporation pulse code to ensure efficient CRISPR editing and post electroporation viability. Manufacturers of electroporation devices often offer helpful advice for cell types, but in house validation and optimisation is critical. Additionally, for the desired endpoint assay, seeding density and culture time post electroporation is likely to need some modification between cell types. Unfortunately, cells which are not amenable for electroporation would not be suitable for this protocol and other methods of CRISPR/Cas9 delivery would need to be explored.
      The protocol described here is designed to be high throughput, therefore, automation is used throughout the protocol to ensure assay consistency and robustness. It is possible for the automation to fail so it is important that the automation platforms are regularly checked, and liquid handling steps optimised with PBS prior to running the screening process. As discussed, some of the automation events can be carried out manually using a multi-channel pipette if required.
      Fig. 4
      Figure 4:
      Figure 4Simplified workflow schematic of the high throughput CRISPRn editing of SAECs for arrayed screening.
      This protocol describes a high throughput workflow to carry out CRISPRn editing of SAEC via RNP electroporation. This workflow can be combined with a myriad of different disease-specific endpoint assays as required and can be adapted to suit a variety of needs.
      ©Agilent Technologies, Inc. Reproduced with Permission, Courtesy of Agilent Technologies, Inc.
      ©Lonza, reproduced with permission.
      ©2022 Beckman Coulter, Inc. Used with Permission.

      Author contributions

      A. D., N. M., and A. S. contributed substantially to the design of the protocol and drafted the manuscript.
      L. E-I. contributed substantially to the design of the protocol and contributed to manuscript revision.
      C.W. and D. G. directed and supervised the project and contributed to manuscript revision.

      Uncited References

      [
      • Brinkman E.K.
      • Chen T.
      • Amendola M.
      • van Steensel B.
      Easy quantitative assessment of genome editing by sequence trace decomposition.
      ]

      Declaration of Competing Interests

      The authors A. D., N. M., A. S., L. EI., C. W., and D. G declare the following competing interest: they are employees of, and shareholders in, AstraZeneca.

      Acknowledgments

      The authors received no financial support for the research, authorship, and/or publication of this article. All authors are employed by AstraZeneca, and their research and authorship of this article was completed within the scope of their employment with AstraZeneca.

      Appendix. Supplementary materials

      References

        • Brinkman E.K.
        • Chen T.
        • Amendola M.
        • van Steensel B.
        Easy quantitative assessment of genome editing by sequence trace decomposition.
        Nucleic Acids Research. 2014; 42
        • Smith J.R.
        • Maguire S.
        • Davis L.A
        • Alexander M.
        • Yang F.
        • Chandran S.
        • ffrench-Constant C.
        • Pedersen R.A
        Robust, persistent transgene expression in human embryonic stem cells is achieved with AAVS1-targeted integration.
        Stem Cells. 2008; 26: 496-504
        • Wang B.
        • Wang M.
        • Zhang W.
        • Xiao T.
        • Chen C.
        • Wu A.
        • Wu F.
        • Traugh N.
        • Wang X.
        • Li Z.
        • Mei S.
        • Cui Y.
        • Shi S.
        • Lipp J.J.
        • Hinterndorfer M.
        • Zuber J.
        • Brown M.
        • Li W.
        • Liu X.S
        Integrative analysis of pooled CRISPR genetic screens using MAGeCKFlute.
        Nature Protocols. 2019; 14: 756-780